(b) Effect of palmitate exposure on the phosphorylation of PKB (Ser473) in Con shRNA and Cs shRNA cells. Symptoms of the disease begin within the first weeks or months of life … The encephalomyopathic form, described in few families, is characterized by exercise intolerance, recurrent myoglobinuria, … CS from a porcine heart was used as a standard (C3260-200UN, Sigma-Aldrich Company Ltd, Gillingham, Dorset, UK) for assay calibration. The authors declare that there are no conflicts of interest regarding the publication of this paper. The cell media was removed and 100 μl of the ice cold lysis buffer was applied. (1979) Eur. Pseudoviruses were produced by cotransfecting HEK293 cells with a plasmid carrying shRNA and the Mission lentiviral packaging mix (SH001, Sigma–Aldrich) containing plasmids expressing viral packaging genes and a heterologous viral envelope gene. 2 μg of RNA was then used for cDNA synthesis in 20 μl reaction volume containing 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 0.5 mM dNTP Mix (0.5 mM each dATP, dGTP, dCTP and dTTP), 5 mM DTT, 150 ng of random primers, and 200 units of SuperScript™ III Reverse Transcriptase. Review articles are excluded from this waiver policy. Also given are values for these enzymes in the leukocytes and fibroblasts from a severely mentally and … Cs shRNA and Con shRNA cells were homogenized in 1 ml of ice cold TRIZOL Reagent (Invitrogen Ltd, Paisley, UK) and RNA extracted using chloroform and isopropanol as described previously [6]. The membranes were washed with Tris buffered saline (TBS) containing 0.1% (vol/vol) Tween-20 (TBS-T buffer) before two hour incubation in the blocking buffer (5% (wt./vol) nonfat milk in TBS-T buffer). Sign up here as a reviewer to help fast-track new submissions. The enzyme citrate synthase E.C. After incubation with a primary antibody, membranes were washed in TBS-T buffer and exposed for 2 h to HRP-conjugated secondary antibody (#7071) at 1 : 2000 dilution in the blocking buffer. P.PKB was normalized to PKB. This site needs JavaScript to work properly. Fat mass (FM) of mice was measured using dual energy X-ray absorptiometry (DEXA; PIXImus2 Series Densitometers with software version 1.46.007; GE Medical Systems Ultrasound and BMD, Bedford, UK). O Citrate synthase Succinate dehydrogenase Phosphofructokinase O Glyceraldehyde-3-phosphate dehydrogenase Aldolase Which reaction in glucose metabolism would be affected by a niacin deficiency… Pelliccione N, Jaffin B, Sobel ME, Krulwich TA. All antibodies were from Cell Signalling Technology (Danvers, MA, USA). A novel variant in COX16 causes cytochrome c oxidase deficiency, severe fatal neonatal lactic acidosis, encephalopathy, cardiomyopathy, ... or mU/mg protein for citrate synthase… B. Metabolisable energy intake (MEI) (, Physical activity and body temperature. Afterwards Con shRNA and Cs shRNA cells were incubated in the media containing 5.5 mM glucose (G) and/or 0.8 mM palmitate (P). Genotyping chromosome 10 in congenic B6.A-(rs3676616-D10Utsw1)/KjnB6 (B6.A) strain. Intramuscular fat of the tibialis anterior (TA) muscle was evaluated using staining of the muscle cross sections with Oil Red dye with the subsequent quantification of the staining intensity. LDL cholesterol (LDL-C) concentration was quantified as suggested by Friedewald et al. Requirement for a functional respiration-coupled D-fructose transport system for induction of phosphoenolypyruvate:D-fructose phosphotransferase activity. Y.A., L.M.V, A.R., A.L., M.A.T., B.M.G., C.H., S.R.G., B.S.A., and JRS collected and analysed the data. Copyright © 2019 Yosra Alhindi et al. ∼106 of cells was lysed in 6 well plates, and light absorbance of lysates was measured at 450 nm using the spectrophotometer. 1979 Mar 15;95(1):69-75. doi: 10.1111/j.1432-1033.1979.tb12940.x. Extraction of tissue fat was carried out using the Soxhlet method. C2C12 muscle cells were treated either with control shRNA (Con shRNA) or Cs shRNA which targeted, Palmitate-induced lipotoxicity in C2C12 muscle cells (Cont). For the CS assay, the molar extinction coefficient used was 13 600 M−1 cm−1 for CoA-5,5′-thiobis(2-nitrobenzoic acid) at 412 nm. Quantification of immunoblots from six experiments. Blood glucose was measured with a glucometer (ACCU-Chek Aviva, Roche, West Sussex, UK) using the whole blood samples taken from cut tail tips immediately before and at 15, 30, 60, and 120 min after the injection. Carlsson, L. Jansson, and M. Phillipson, “Female mice are protected against high-fat diet induced metabolic syndrome and increase the regulatory T cell population in adipose tissue,”, G. S. Hotamisligil, “Inflammation and metabolic disorders,”, D. K. Choi, T. S. Oh, J.-W. Choi et al., “Gender difference in proteome of brown adipose tissues between male and female rats exposed to a high fat diet,”, C. R. Hancock, D.-H. Han, M. Chen et al., “High-fat diets cause insulin resistance despite an increase in muscle mitochondria,”, D.-H. Han, C. R. Hancock, S. R. Jung, K. Higashida, S. H. Kim, and J. O. Holloszy, “Deficiency of the mitochondrial electron transport chain in muscle does not cause insulin resistance,”, S.-H. Wu, L.-N. Zhang, J. R. Speakman, and D.-H. Wang, “Limits to sustained energy intake. Then, measurements of citrate synthase (CS) and β-hydroxyacyl-coenzyme (CoA) dehydrogenase (HAD) activity were carried out at room temperature of 21°C using the spectrophotometer (GENESYS 10 Bio UV-Vis, Thermo Fisher Scientific Inc., Waltham, MA, USA). ), Bader S. Alanazi (B.S.A. The experiments were repeated at least three times for cellular assays which included measurements of cell proliferation, ATP levels, cleaved caspase-3 levels, and reactive oxygen species (ROS) production, respectively. IPR016142 Citrate synthase-like, large alpha subdomain. Pyruvate Dehydrogenase Complex Deficiency The PDH complex converts pyruvate, which is derived from the catabolism of glucose, to acetyl-CoA, which enters the TCA cycle at citrate … The isotope ratios 18O to 16O and 2H to 1H were analysed using gas source isotope ratio mass spectrometry (ISOCHROMμGAS system and IsoPrime IRMS, Micromass, Manchester, UK). 1972 Oct;112(1):356-64. doi: 10.1128/JB.112.1.356-364.1972. The proximal boundary of the congenic region in the B6.A strain was genotyped in order to refine the recombination site. Blood samples were immediately heat sealed into two 50 μl glass capillaries and stored at room temperature. Air that leaves the animal chamber was dried by silica gel and 150 ml min−1 was passed through a gas analyser (Servomex 1100A or Servomex Xentra, Servomex Ltd, Crowborough, UK). Extracts of cells of JF3 grown on 10 mM citrate to the mid-logarithmic phase contained citrate synthase at a specific activity of 0.05 pmol of citrate … Genomic DNA was extracted from muscle tissue obtained of B6.A as well as B6 and A/J, to provide positive control, using the hot sodium hydroxide and Tris (HotSHOT) method [36] Genomic segments flanking four SNPs partitioning the region of interest and polymorphic between the B6 and A/J strains were amplified by PCR using pairs of primers provided in parenthesis; rs29356783 (forward-AAGAGGAAGAGCCGAAAAGG; reverse-TAGGCATGATCAAGCACGAG), rs232632450 (GGGAATCAAACCCAGATCCT; ATGTGGGTCCCAGAAATCAA), rs48666233 (TAAATTTCAGGCGAGCTGGT; GCCTTTTCTTTCCTCCGTCT) and rs45825880 (TCCTTGTCGAGCTCCTCCTA; CCTCTTGGGAGGAAACAAGG). Revisiting the glyoxylate cycle: alternate pathways for microbial acetate assimilation. A mutant lacking acetyl-CoA synthetase exhibited no induction of the glyoxylate pathway in the presence of acetate, although acetate uptake was normal. The deficiency is characterized clinically by salt-wasting, failure to thrive, and growth retardation. Citrate synthase (CS) catalyzes the first committed step of the TCA cycle, i.e. The data are presented for the baseline period of high carbohydrate diet (HCD) feeding followed by HFD feeding for 2 weeks (HFD2), 6 weeks (HFD6), and 12 weeks (HFD12). The staining of the background was subtracted from the sample staining. RMR final quantification was measured as the oxygen consumption over the lowest 20 consecutive values (10 min interval) and corrected for ambient temperature and pressure. When cells became confluent, the medium was changed to the differentiation medium containing 96% DMEM, 5.5 mM glucose, 2% horse serum, and 2 mM glutamine. Citrate synthase, a non-iron containing citrate cycle … A test of the heat dissipation limitation hypothesis in lactating Brandt’s voles (, J. R. Speakman and E. Król, “Comparison of different approaches for the calculation of energy expenditure using doubly labeled water in a small mammal,”, J. Secondly, crystal violet staining was applied [39]. The results indicate a role for acetyl-CoA as inducer of the glyoxylate pathway. The mean urinary citrate excretion is 640 mg/d in healthy individuals. The data are also presented for congenic (10C1) strain in [. The extent of shRNA-mediated Cs knockdown was assessed using the real time RT-PCR and measurements of CS activity using the spectrophotometric CS assay on Cs shRNA and Con shRNA cells. We found that aco1Δ activated the RTG pathway, resulting in increased expression of genes encoding citrate synthase. The enzyme activity was analysed as in our previous studies [6, 20]. Citrate synthase catalyzes the condensation of oxaloacetate with acetyl CoA to form citrate. Quantification of immunoblots from six experiments. and S.R.G. Molecular Reagents less. The data used to support the findings of this study are available from the corresponding author upon request. Powered by netvibes. Mice were anesthetized by inhalation of a mixture of isoflurane and oxygen for the duration of the scan (∼3 min). 1974 May;71(5):1739-42. doi: 10.1073/pnas.71.5.1739. In experiments with glucose (G experiments), the differentiated Cs shRNA and Con shRNA myotubes were incubated in the differentiation media supplemented with 2% (wt/vol) fatty acid-free BSA and 1.2 mM L carnitine for up to 18 h. In experiments with mixture of glucose and palmitate (G + P experiments), 0.8 mM palmitate was added to the media. Disruption of the gene was found to … Although in eukaryotes it is a mitochondrial enzyme, and in fact, is often used as a enzyme marker for intact mitochondria, it is encoded by nuclear DNA. A citrate-synthase-deficient mutant had the following properties: (a) high constitutive levels of glyoxylate pathway enzymes on various substrates, while such levels were only found in the wild type when it was grown on acetate; (b) acetyl-CoA levels much higher than in the wild type … J Bacteriol. Black, white, and gray colours mark alleles of C57BL/6J (B6), A/J genotype, and unknown genotype, respectively. General linear models were used in the analysis. ), and European Social Fund under the Global Grant Measure (VP1-3.1-ŠMM-07-K-02-057) (to A.L. The reaction reagent consisted of 100 mM triethanolamine-HCl, dithiobis(2-nitrobenzoic acid), 0.5 mM Triton-X (0.25% vol/vol), oxaloacetate, and 0.31 mM acetyl CoA with pH adjusted to 8.0. [. C2C12 mouse muscle cells were used to investigate the effects of reduced CS activity on palmitate-induced lipotoxicity. Most cases present with neonatal-onset hypotonia, lactic acidosis, hyperammonemia, hypertrophic cardiomyopathy, and 3-methylglutaconic aciduria. Body mass and composition of mice. The membranes were incubated for 18 h at 4°C with a primary antibody at 1 : 1000 dilution (vol/vol) TBS-T buffer supplemented with 5% bovine serum albumin. 2000 Mar;18(3):99-102. doi: 10.1016/s0167-7799(99)01417-1. Values (, Energy balance and resting metabolic rate of mice. citrate synthase (E.C. The overnight fasted mice were subject to an intraperitoneal glucose injection (2 g glucose (kg body wt)−1). Citrate in the urine has long been recognized as an inhibitor of calcium salt crystallization. L.M.V., Y.A., A.L., and A.R. | All … Three high-enrichment standards were analysed each day alongside the samples. It is the first step of the citric acid cycle, also known as the Krebs cycle.Glucose has previously been broken into … Palmitate-induced lipotoxicity in C2C12 muscle cells. The lysed cells were transferred into the plastic tubes and snap frozen in the liquid nitrogen. A. Walker, and M. L. Warman, “Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT),”, K. I. Watt, R. T. Jaspers, P. Atherton et al., “SB431542 treatment promotes the hypertrophy of skeletal muscle fibers but decreases specific force,”, C. Martin-Granados, A. Philp, S. K. Oxenham, A. R. Prescott, and P. T. W. Cohen, “Depletion of protein phosphatase 4 in human cells reveals essential roles in centrosome maturation, cell migration and the regulation of Rho GTPases,”, R. Gherzi, M. Trabucchi, M. Ponassi, I.-E. Gallouzi, M. G. Rosenfeld, and P. Briata, “Akt2-mediated phosphorylation of Pitx2 controls Ccnd1 mRNA decay during muscle cell differentiation,”. atom%). For HAD assay, the molar extinction coefficient used was 63,000 M−1 cm−1 for NADH at 340 nm. The aim of this study was to test the hypothesis that low CS activity impairs the metabolic health of mice fed a high fat diet (HFD) … The 1000 μL of reaction reagent included 20 μL of muscle homogenate. The imaging of blots was performed using ECL reagent (Amersham Biosciences, Buckinghamshire, UK) and Fluor-SMax Imager (Bio-rad, Hertfordshire, UK). Tissue fat mass was calculated by subtraction of dry mass of sample and thimble after and before extraction. Citrate synthase and long-chain fatty acyl-CoA dehydrogenase, used as markers for the citrate cycle and fatty acid oxidation pathways, were unaffected by the iron deficiency. The amplicons were afterwards digested using AluI (Thermo Scientific, UK), BtgI (New England Biolabs, UK), HpyCH4V (New England Biolabs, UK) or NciI (Fermentas Life Sciences, UK) restriction enzymes, respectively, following manufacturer recommendation. For these experiments, 2 × 106 cells were seeded in six well plates coated with extracellular matrix gel (E6909, Sigma-Aldrich, MO, USA) and containing 2 ml of the growth medium. By deleting RTG1, RTG3, or genes encoding citrate synthase, mtDNA instability was prevented in aco1Δ mutant cells. This work was supported by Saudi Ministry of Higher Education Grant (to Y.A.
Noisy Neighbors Maryland,
June Ponal July Katre,
Lips With Leopard Tongue Shirt,
Citrus Pear Reviews,
Famous Aboriginal Songs,
Math In Focus Grade 7 Workbook,
The Moody Blues Every Good Boy Deserves Favour Songs,
Removing Surgical Staples,